Authors: (All colleagues are welcome to take part)
Reviewer: (All colleagues are welcome to take part)
Global Clone 1 Lineage 3 (GC1 L3) was first identified in 2021 based on the results of a genome-wide recombination-free single nucleotide polymorphism (SNP)-based phylogenitic analysis of selected GC1 isolates (Hamidian & Hall, 2021). In this study, GC1 L3 included only four A. baumannii isolates (5457, VB2486, VB29123, and VB24139) that were all collected in India. A few months later, comparitive analysis of the arrays of clustered regularly interspaced short palindromic repeats (CRISPR) of 187 isolates belonging to GC1 demonstrated a well-demarcated cluster of six CRISPR-based sequence types (CST), namely CST57, CST58, CST59, CST60, CST63, and CST66, that were linked to GC1 L3 (Karah et al., 2021). This cluster included a total of 8 isolates (5457, VB2486, SP2486, VB24139, Ab-Pak-Lah-14, Ab-Pak-Pesh-05, Ab-Pak-Pesh-37, and MRSN15049) obtained between 2013 and 2019 from Afghanistan, Pakistan, and India.
The acquisition of unique CRISPR spacers (Ab-935 to Ab-940) was considered as a characteristic event in the evolution of the CSTs of GC1 L3 (Karah et al., 2021). Accordingly, the nucleotide sequence of Ab-935 and the two surrounding repeats (GTTCATGGCGGCATACGCCATTTAGAAATTGCTTAACCTTCACGCCATTTGGATAAACTGGTTCATGGCGGCATACGCCA-TTTAGAAA) could be used as a BLASTn search query to screen whole-genome nucleotide databases for isolates belonging to GC1 L3.
GC1 L3 is also characterized by the occurence of blaOXA-371 as their intrinsic blaOXA-51-like gene. blaOXA-371 has a nucleotide identity of 824/825 to blaOXA-69 (GenBank accession numbers NG_049662.1 and NG_049809.1),
The GC1 L3 isolates are assigned into ST1P (1, 1, 1, 1, 5, 1, 1), ST623P (1, 1, 2, 1, 5, 1, 1), and ST1106P (2, 1, 2, 1, 5, 1, 1).
As of January 2023, our in-silico screening enabled us to detect 30 isolates that might belong to GC1 L3 (Table 1). The genomic records of these isolates either had Ab-935 and the two surrounding repeats, were positive for blaOXA-371 (100% nucleotide identity), and/or belonged to ST623P (1, 1, 2, 1, 5, 1, 1) or ST1106P (2, 1, 2, 1, 5, 1, 1).
The isolates were collected between 2013 and 2021 from Nepal (n=17), Pakistan (n=7), India (n=6), Afghanistan (n=1), and Bangladesh (n=1). One isolate was collected in Sweden!

Most of the GC1 L3 isolates are resistant to ≥3 classes of antibiotics and can be described as either multidrug-resistant or extensively drug-resistant (Galac et al., 2020; Karah et al., 2020; Vijayakumar et al., 2022).
most of the isolates (maybe all the isolates) have ISAba1 upstream of their intrinsic ampC genes.
Some isolates have ISAba1-ampC-8 or ISAba1-ampC-3. The nucleotide identity of ampC-8 (1167 bp) is 100% identical to ampC-3 (1152 bp) apart from having a duplicated segment of 15 nucleotides ().
A. baumannii isolate VB2486 (also known as AB28) carried four antibiotic resistance genes on the chromosome (Vijayakumar et al., 2022), namely: strA, strB, blaNDM−1, and sul2. In addition, VB2486 had 6 plasmids, on which additional four resistance genes were detected (blaOXA-23, mphE, msrE, and aphA6).
Tn6171-v1, a 49124-bp long transposon, was detected in the chromosome of A. baumannii strain 5457 (GenBank: CP045541.1) downstream of glmS surrounded by a target site duplication of 5 bp (AAGGC).
In addition to the transposition genes, Tn6171 contains genes encoding proteins with iron acquisition, metabolism, efflux pumps and regulatory predicted functions ().
which is a variant of a Tn7-family transposon that carries genes for synthesis and uptake of the fimsbactin siderophore system, with other L3 members (VB24319, VB29123 and VB2486) carry another variant called Tn6171-v2 [38]. SP2486, which clusters with VB24319, VB29123 and VB2486, also carries the same variant, Tn6171-v2. However, MRSN15049 (recovered in Afghanistan) does not carry Tn6171 or a variant of Tn6171, indicating that it has evolved differently and that the acquisition of fimsbactin encoding transposons is associated with L3 strains recovered in India.
Hamidian M, Hall RM. Dissemination of novel Tn7 family transposons carrying genes for synthesis and uptake of fimsbactin siderophores among Acinetobacter baumannii isolates. Microb Genom. 2021 Mar;7(3):mgen000548.
PMID: 33749577
Karah N, Wai SN, Uhlin BE. CRISPR-based subtyping to track the evolutionary history of a global clone of Acinetobacter baumannii. Infect Genet Evol. 2021 Jun;90:104774.
doi: 10.1016/j.meegid.2021.104774
PMID: 33618003
Koong J, Johnson C, Rafei R, Hamze M, Myers GSA, Kenyon JJ, Lopatkin AJ, Hamidian M. Phylogenomics of two ST1 antibiotic-susceptible non-clinical Acinetobacter baumannii strains reveals multiple lineages and complex evolutionary history in global clone 1. Microb Genom. 2021 Dec;7(12):000705.
PMID: 34874246
Higgins PG, Kniel M, Rojak S, Balczun C, Rohde H, Frickmann H, Hagen RM. Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii strains isolated at the German military field laboratory in Mazar-e Sharif, Afghanistan. Microorganisms. 2021 Oct 26;9(11):2229.
doi: 10.3390/microorganisms9112229
PMID: 34835355
Vijayakumar S, Jacob JJ, Vasudevan K, Mathur P, Ray P, Neeravi A, Baskaran A, Kirubananthan A, Anandan S, Biswas I, Walia K, Veeraraghavan B. Genomic characterization of mobile genetic elements associated with carbapenem resistance of Acinetobacter baumannii from India. Front Microbiol. 2022 Jun 15;13:869653.
doi: 10.3389/fmicb.2022.869653
PMID: 35783393
Galac MR, Snesrud E, Lebreton F, Stam J, Julius M, Ong AC, Maybank R, Jones AR, Kwak YI, Hinkle K, Waterman PE, Lesho EP, Bennett JW, Mc Gann P. A diverse panel of clinical Acinetobacter baumannii for research and development. Antimicrob Agents Chemother. 2020 Sep 21;64(10):e00840-20.
doi: 10.1128/AAC.00840-20
PMID: 32718956
Karah N, Khalid F, Wai SN, Uhlin BE, Ahmad I. Molecular epidemiology and antimicrobial resistance features of Acinetobacter baumannii clinical isolates from Pakistan. Ann Clin Microbiol Antimicrob. 2020 Jan 15;19(1):2.
doi: 10.1186/s12941-019-0344-7
PMID: 31941492
Shrestha S, Tada T, Miyoshi-Akiyama T, Ohara H, Shimada K, Satou K, Teruya K, Nakano K, Shiroma A, Sherchand JB, Rijal BP, Hirano T, Kirikae T, Pokhrel BM. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii isolates in a university hospital in Nepal reveals the emergence of a novel epidemic clonal lineage. Int J Antimicrob Agents. 2015 Nov;46(5):526-31.
doi: 10.1016/j.ijantimicag.2015.07.012
PMID: 26362951